View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11683_low_14 (Length: 218)
Name: NF11683_low_14
Description: NF11683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11683_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 17 - 131
Target Start/End: Original strand, 2451335 - 2451449
Alignment:
| Q |
17 |
agtgaaaattggaaaacaagaacaaattttcaattgttctctcttctaaggtccctttcaccttctgtgggagtcttgtgtttgatcgattatccttaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2451335 |
agtgaaaattggaaaacaagaacaaattttcaattgttctctcttctaaggtccctttcaccttctgtgggagtcttgtgtttgatcgattatccttaat |
2451434 |
T |
|
| Q |
117 |
ctgatcatgggtgtg |
131 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2451435 |
ctgatcatgggtgtg |
2451449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 49
Target Start/End: Original strand, 23730009 - 23730041
Alignment:
| Q |
17 |
agtgaaaattggaaaacaagaacaaattttcaa |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23730009 |
agtgaaaattggaaaacaagaacaaattttcaa |
23730041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University