View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11684_high_7 (Length: 228)
Name: NF11684_high_7
Description: NF11684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11684_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 19 - 213
Target Start/End: Complemental strand, 28323794 - 28323602
Alignment:
| Q |
19 |
tataattttgttttctcttggacatgataacactggaaagagcagttctatgatttttaatccttataaaataaattatcatgaagactcaaaacacaaa |
118 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||| ||||||||| | | ||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
28323794 |
tataatttttttttctcttggacatgataacaccggaaagagctgttctatgactct-aatccttataaaataaattgtcatgaacactcaaaacacaaa |
28323696 |
T |
|
| Q |
119 |
agtcgtgtctggtaccgaagtctgccaatnnnnnnnntctcaactagcaaaggatttgaatgggtcatcaaagaagacgtattttggcatctctg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
28323695 |
agtcgtgtctggtaccgaagtctgccaat-aaaaaaatctcaactagcaaaggatttgaatgggtcattaaagaagacgtattttggtatctctg |
28323602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University