View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11684_low_4 (Length: 260)
Name: NF11684_low_4
Description: NF11684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11684_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 41706258 - 41706440
Alignment:
| Q |
1 |
tacgaacgtaatcgtgatcttcaaattcgagtaaacaaacggcacagtcacggcgagattcttgttcgtatttagttgtgtagataaagaatgggattgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41706258 |
tacgaacgtaatcgtgatcttcaaattcgagtaaacaaacggcacagtcacggcgagattcttgttcgtatttagttgtgtagataaagaatgggattgt |
41706357 |
T |
 |
| Q |
101 |
tttgatgatagattcgtctaaaccgtaggtgagtggtgtttcgaaagatgttgagtcgtattgaagggattcaatatcgccta |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41706358 |
tttgatgatagattcgtctaaaccgtaggtgagtggtgtttcgaaagatgttgagtcgtattgaagggattcaatatcgccta |
41706440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Original strand, 41706464 - 41706494
Alignment:
| Q |
207 |
cggtggaagcgttgaatgagacggtggatgg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41706464 |
cggtggaagcgttgaatgagacggtggatgg |
41706494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University