View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11684_low_7 (Length: 233)
Name: NF11684_low_7
Description: NF11684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11684_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 20 - 218
Target Start/End: Original strand, 49450879 - 49451078
Alignment:
| Q |
20 |
agatagtgtattattagcacatggaagtggttcatagatcaccatacatatgcccagatttgaaaatctacatcagtgggaatttaggagtaggcgacga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49450879 |
agatagtgtattattagcacatggaagtggttcatagatcaccatacatatgcccagatttgaaaatctacatcagtgggaatttaggagtaggcgacga |
49450978 |
T |
|
| Q |
120 |
ctctcaactcccacaat-nnnnnnnnnnnnntagtaactagaaagcagtgcatgcaacaattaacatgaaataaattgtgaattaagagacgtacctatg |
218 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
49450979 |
ctctcaactcccacaataaaaaatttaaaaatagtaactagaaagcagtgcatgcaataattaacatgaaataaattgtgaattaagaaacgtacctatg |
49451078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University