View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11685_high_18 (Length: 327)
Name: NF11685_high_18
Description: NF11685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11685_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 161 - 309
Target Start/End: Original strand, 37137189 - 37137337
Alignment:
| Q |
161 |
ataacgaaattttctaatgcactaataaacatggcaatgtg-----tgcttaatgtgtttgtttgtatgtgtatattttatgtaggagctagagaaccct |
255 |
Q |
| |
|
||||||| ||||||||| || ||||||||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
37137189 |
ataacgattttttctaatacattaataaacatggcaatgtgcaatttgcttaatgtgtt-----gtatgtgtatatgatatgtaggagctagagaaccct |
37137283 |
T |
|
| Q |
256 |
ttcgttttcgaagaaggtcaacatcagatgcgtacgagaaggagaagacaggca |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37137284 |
ttcgttttcgaagaaggtcaacatcagatgcgtacgagaaggagaagacaggca |
37137337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University