View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11685_high_25 (Length: 209)
Name: NF11685_high_25
Description: NF11685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11685_high_25 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 38386645 - 38386838
Alignment:
| Q |
18 |
gacggcacatgggaatgagaaacaagaacaactctaattgaaagagaattgaggagctacacgggcaacacatcataactctatcggtttaatttctcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
38386645 |
gacggcacatgggaatgagaaacaagaacaactctaattgaaagagaattgaggagctacacaggcaacacatcagaactctattggtttaatttttcta |
38386744 |
T |
 |
| Q |
118 |
ctatgtttcttatttctaa--ctcatagagattaggtctaaaatgaatctaatgtactctgttttgaaccaaccatgttgttgtgaaactctat |
209 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38386745 |
ctatctttcttatttctaaatctcttagagattaggtctgagatgaatctaatgtattctgttttgaaccaaccatgttgttgtgaaactctat |
38386838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University