View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11685_high_26 (Length: 207)

Name: NF11685_high_26
Description: NF11685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11685_high_26
NF11685_high_26
[»] chr6 (1 HSPs)
chr6 (17-186)||(34872209-34872378)


Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 186
Target Start/End: Original strand, 34872209 - 34872378
Alignment:
17 gaactcatgatgcatatgtagacactttgaataacctttagtcattgcagttttaccccggccagcggttcccaggtcttgaataaccttcagctttaga 116  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||    
34872209 gaactcatgatgcatatgtagacactttgaataaccttcagtcattgcagttttgctccggccagcggttcccaggtcttgaataaccttcagctttaga 34872308  T
117 tcactgcggcaaatggtcgagtgggggccatatcgatcaggatcggaccgcacgttcaacagctggagca 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||    
34872309 tcactgcggcaaatggtcgagtgggggccatatcgatcaggatcggaccacacgttcaacagttggagca 34872378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University