View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11685_high_26 (Length: 207)
Name: NF11685_high_26
Description: NF11685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11685_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 186
Target Start/End: Original strand, 34872209 - 34872378
Alignment:
| Q |
17 |
gaactcatgatgcatatgtagacactttgaataacctttagtcattgcagttttaccccggccagcggttcccaggtcttgaataaccttcagctttaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34872209 |
gaactcatgatgcatatgtagacactttgaataaccttcagtcattgcagttttgctccggccagcggttcccaggtcttgaataaccttcagctttaga |
34872308 |
T |
 |
| Q |
117 |
tcactgcggcaaatggtcgagtgggggccatatcgatcaggatcggaccgcacgttcaacagctggagca |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
34872309 |
tcactgcggcaaatggtcgagtgggggccatatcgatcaggatcggaccacacgttcaacagttggagca |
34872378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University