View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11685_high_27 (Length: 204)
Name: NF11685_high_27
Description: NF11685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11685_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 22 - 186
Target Start/End: Original strand, 19502059 - 19502223
Alignment:
| Q |
22 |
atagttttgggtaaagatggtatccacacttgtggggttactttcgatttaggtcattgttttcggactcctctcatgatccaagagaaaaccctaacat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19502059 |
atagttttgggtaaagatggtatccacacttgtggggttactttcgatttaggtcattgttttcggactcctctcatgatccaagagaaaaccctaacat |
19502158 |
T |
 |
| Q |
122 |
tcctttcagatgcataaaattacataaaaatctaataatatgtatattgcccaaaatatatatct |
186 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
19502159 |
tccttttggatgcataaaattacataaaaatttaataatatgtatattgctcaaaatatatatct |
19502223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University