View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11685_low_18 (Length: 330)
Name: NF11685_low_18
Description: NF11685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11685_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 97 - 312
Target Start/End: Original strand, 38887042 - 38887260
Alignment:
| Q |
97 |
gatgggtgaaaaccttccataaatataaatataaatttgtatatggttctttcttat---tagaggaaattgtggaacatttaagatatatgatagctag |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38887042 |
gatgggtgaaaaccttccataaatataaatataaatttgtatatggttctttcttattattagaggaaatagtggaacatttaagatatatgatagctag |
38887141 |
T |
 |
| Q |
194 |
ggttggctttaatgataaaggaaaggttgtagattgttggttgtttttggtgaaaaagaaaaggaagtgaaatgtttgtggaaaagaacgcttttaggga |
293 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38887142 |
ggttggctttaatgataaaggaaaggttatagattgttggttgtttttggtgaaaaagaaaaggaagtgaaatgtttgtggaaaagaacgcttttaggga |
38887241 |
T |
 |
| Q |
294 |
agcacctaagaggggaaag |
312 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
38887242 |
agcacctaagaggggaaag |
38887260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 15 - 48
Target Start/End: Original strand, 38886966 - 38886999
Alignment:
| Q |
15 |
agcagagatagggaaagtgtaagaaaaagaaggg |
48 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
38886966 |
agcagtgatagggaaagtgtaagaaaaagaaggg |
38886999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University