View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11685_low_23 (Length: 297)
Name: NF11685_low_23
Description: NF11685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11685_low_23 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 297
Target Start/End: Original strand, 32191875 - 32192171
Alignment:
| Q |
1 |
aagtaacgagttcaactgtatttatcgatgaaatagggtttgttgcagtatgcatcagcagattcattattgaattctagtgatattaagtttcttttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
32191875 |
aagtaacgagttcaactgtatttatcaatgaaatagggtttgttgcagtatgcagcagcagattcattactaaattctagtgacgttaagtttcttttta |
32191974 |
T |
 |
| Q |
101 |
cttaccatctttgtaaggatcgaggagaacgaagtctagaagttcataaggtccaaacaagtcactctcatggatatcccattctctgaacaagtctctt |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32191975 |
cttaccatcttcgtaaggatcgaggagaacgaagtctagaagttcataaggtccaaacaagtcactctcatggatatcccattctctgaacaagtctctt |
32192074 |
T |
 |
| Q |
201 |
agccgaataacctcgctttcattgaaagtatgagagcttgtattatcaacatattcagggaaaagcttcaagtacattctcaatcgaccttcttccc |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32192075 |
agccgaataacctcgctttcattgaaagtatgagagcttgtattatcaacatattcaggaaaaagcttcaagtacattctcaatcgaccttcttccc |
32192171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 217 - 280
Target Start/End: Complemental strand, 28287823 - 28287760
Alignment:
| Q |
217 |
tttcattgaaagtatgagagcttgtattatcaacatattcagggaaaagcttcaagtacattct |
280 |
Q |
| |
|
||||||||||||||||||| || ||| |||||||||| |||||||| |||||||| |||||| |
|
|
| T |
28287823 |
tttcattgaaagtatgagaactattatgatcaacatataaagggaaaaacttcaagtccattct |
28287760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University