View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11686_high_14 (Length: 280)
Name: NF11686_high_14
Description: NF11686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11686_high_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 264
Target Start/End: Original strand, 43200022 - 43200258
Alignment:
| Q |
18 |
tattctgtaccaagtactattgtaagtatattgtgctctaatgcatgtactactttaattatcttggtaaaattaataatgggatctaaaggttgatagg |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43200022 |
tattctgtaccaagtaccattgtaagtatatggttctctaatgcatgtactactt----------ggtaaaattaataatgggatctaaaggttgatagg |
43200111 |
T |
|
| Q |
118 |
aattaagagatggcaattgttaattaataatgataatgattcgaatgtatacgttcagatacatgtttcatccactttaaacctcttgttttggatgcag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43200112 |
aattaagagatggcaattgttaattaataatgataatgattctaatgtatacgtccagatacatgtttcatccactttaaacctcttgttttggatgcag |
43200211 |
T |
|
| Q |
218 |
aatatgcatgtgttggataaccaaataaagcatataagaattctttg |
264 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43200212 |
aatatgcatgtgttggataaccaaatatagcatataagaattctttg |
43200258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University