View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11686_high_21 (Length: 228)
Name: NF11686_high_21
Description: NF11686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11686_high_21 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 71 - 228
Target Start/End: Complemental strand, 41984888 - 41984731
Alignment:
| Q |
71 |
tatctaataaagacatggttccatgagaatataccgcacataattggtttgaacctttggtttattgaaatgccgtgttgattatgattgtccaatcgat |
170 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41984888 |
tatctaataaagacatggttccatgataatataccacacataattggtttgaacctttggtttattgaaatgccgtgttgattatgattgtccaatcgat |
41984789 |
T |
 |
| Q |
171 |
agtgaaatacaaaaacacagcaaaaatatatacgttatttatgttttattgcaaatta |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41984788 |
agtgaaatacaaaaacacagcaaaaatatatacgttatttatgttttattgcaaatta |
41984731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 7 - 58
Target Start/End: Complemental strand, 41985009 - 41984958
Alignment:
| Q |
7 |
atatgagtgaggaaagtacagttacaacttgcaattgacacaacatatgcag |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41985009 |
atatgagtgaggaaagtacagttacaacttgcaattgacacaacatatgcag |
41984958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 58
Target Start/End: Complemental strand, 41987561 - 41987517
Alignment:
| Q |
14 |
tgaggaaagtacagttacaacttgcaattgacacaacatatgcag |
58 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||| | ||||||| |
|
|
| T |
41987561 |
tgaggaaagtgcagttgcaacttgcaattgacacagcttatgcag |
41987517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University