View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11686_high_23 (Length: 216)
Name: NF11686_high_23
Description: NF11686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11686_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 20 - 209
Target Start/End: Complemental strand, 14288851 - 14288667
Alignment:
| Q |
20 |
gtctctaaaattttatctcactcaacagcattacaagctctcaatttttaccctttgggttttatggtacatcctctactactaaaagagattatattat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||| |
|
|
| T |
14288851 |
gtctctaaaattttatctcactcaacagcactacaagctctcaatttttaccctttgggttttatggtacatcctcgactactaaaatatattatattat |
14288752 |
T |
 |
| Q |
120 |
acaccctttcacgtaatgtcaagcaattagaatagaaatcaacctcttatgtgatgttcaacatttaccacgctgcttattttcatctca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14288751 |
acaccctttcacgtaatgtcaagcaatt-----agaaatcaatctcttatgtgatgttcaacatttaccacgctgcttattttcatctca |
14288667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University