View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11686_low_31 (Length: 201)
Name: NF11686_low_31
Description: NF11686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11686_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 20 - 189
Target Start/End: Complemental strand, 21323407 - 21323241
Alignment:
| Q |
20 |
acagcttgatgtataattagcacaatctttgtagttatcgcttttatcgtaacaaattcttatttcaagcaaatattcttttgtagggtcacaaacaatt |
119 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21323407 |
acagcttgttgtataactagcacaatctttgtagttatcgcttttatcgtagcaaattcttatttcaagcaaatattcttttgtagggtcacaaacaatt |
21323308 |
T |
|
| Q |
120 |
tgtggctcttttttgttgatatgattctttatagcagcctcaatgtcagttttcttaacgagttcatctc |
189 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
21323307 |
tgtggctctttt---tttatatgattctttatagcagcctcaatgtcagttctcttaacgagttcttctc |
21323241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University