View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11687_low_5 (Length: 317)
Name: NF11687_low_5
Description: NF11687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11687_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 111 - 302
Target Start/End: Complemental strand, 42995443 - 42995250
Alignment:
| Q |
111 |
tacatagttgagtatgatgtcgaagatgtgggtagtccttcctcatcttgctgtcgtttcatcctggggttt-attgttactgttattg-caattagata |
208 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||||||| |||| |||||||||||| |||||| |||||||||||||||| |||||||||| |
|
|
| T |
42995443 |
tacatatttgagtatgtcgtcgaagatgtgggtagtccttcctcatgttgccatcgtttcatcctagggttttattgttactgttattggcaattagata |
42995344 |
T |
|
| Q |
209 |
tttgaaatttggtggcatgcttaagagttggaggatggagttttcaagtttatttggtttttgtttgatgttgttctaagtttattagtttagc |
302 |
Q |
| |
|
| |||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||| || ||||||| |
|
|
| T |
42995343 |
tctgaaatttggtggcatgcttcagagttagaggatggagttttcaagtttttttggtttttgtttgatgatgttctaagttttttggtttagc |
42995250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 17559642 - 17559530
Alignment:
| Q |
1 |
tgatatttcaattctgcttttttagttgcgtttatacattaagtcaatgatgttttaactgcacagtttttcatgatttagaaatcaattagtgattaaa |
100 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17559642 |
tgatatttcaattctgcatttttatctgcgtttatactttaagtcaatgatgttttaactgcatagtttttcatgatttagaaatcaatcagtgattaaa |
17559543 |
T |
|
| Q |
101 |
gccacacatctac |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
17559542 |
gccacacatctac |
17559530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University