View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11688_high_3 (Length: 273)
Name: NF11688_high_3
Description: NF11688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11688_high_3 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 16 - 273
Target Start/End: Complemental strand, 32483524 - 32483267
Alignment:
| Q |
16 |
atgaaatatggtggagattttaagcttgaacataaacacacgcaatcgatacggttggattgttagcagatatagttccaaaactatgtcatcagtattt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483524 |
atgaaatatggtggagattttaagcttgaacataaacacacgcaatcgatacggttggattgttagcagatatagttccaaaactatgtcatcagtattt |
32483425 |
T |
 |
| Q |
116 |
ggctatctttttcagagaattcctctaaaccaaaagattctctctttgtttttgctttcctttatttcaccactcactctcttaaccataacactgaaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483424 |
ggctatctttttcagagaattcctctaaaccaaaagattctctctttgtatttgctttcctttatttcaccactcactctcttaaccataacactgaaaa |
32483325 |
T |
 |
| Q |
216 |
gggtcaatcacggaaactgctagtgcttctgattaatacaccttacaccttatgtcac |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32483324 |
gggtcaatcacggaaactgctagtgcttctgattaatacaccttacaccttatgtcac |
32483267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University