View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11688_low_1 (Length: 334)
Name: NF11688_low_1
Description: NF11688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11688_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 327
Target Start/End: Complemental strand, 37444626 - 37444300
Alignment:
| Q |
1 |
aagtttgtattcaattctgagtttctgtcggttttgatcaaaaaacctttttcggggtgggggtttgtggtttgaatggaacttcagatatctattatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37444626 |
aagtttgtattcaattctgagtttctgtcggttttgatcaaaaaacctttttcggggtgggggtttgtggtttgaatggaacttcagatatctattatag |
37444527 |
T |
|
| Q |
101 |
gattcagatgcattgcatacatgactgcaatcagtttaacttccagaataagttatttcgtttggtaacaataaacttgtgggtcaatgttgatactttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37444526 |
gattcagatgcattgcatacatgactgcaatcagtttaacttccagaatatgttatttcgtttggtaacaataaacttgtgggtcaatgttgatactttg |
37444427 |
T |
|
| Q |
201 |
ttttggacttttggtaacgagtgatgggattttgcagggtgatccggtgtcctgtgaacgatgtggtggcaacggtaattatctttctgcatttggactt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37444426 |
ttttggacttttggtaacgagtgatgggattttgcagggtgatccggtgtcctgtgagcgatgtggtggcaacggtaattatctttctgcatttggactt |
37444327 |
T |
|
| Q |
301 |
caagattgttgtgcttttttgttgttt |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37444326 |
caagattgttgtgcttttttgttgttt |
37444300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University