View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11688_low_8 (Length: 229)

Name: NF11688_low_8
Description: NF11688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11688_low_8
NF11688_low_8
[»] chr6 (3 HSPs)
chr6 (59-128)||(31614431-31614500)
chr6 (6-56)||(31614486-31614536)
chr6 (192-229)||(31614355-31614392)


Alignment Details
Target: chr6 (Bit Score: 62; Significance: 6e-27; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 59 - 128
Target Start/End: Complemental strand, 31614500 - 31614431
Alignment:
59 acgaacatatgacaccgagacaccggacacaattttgtcaaatcaagaagtagaagcatctcttatgaag 128  Q
    ||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||    
31614500 acgaacatatgacactgagacaccagacacaattttgtcaaatcaagaagtagaagcatctcttatgaag 31614431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 6 - 56
Target Start/End: Complemental strand, 31614536 - 31614486
Alignment:
6 aacatcatttaacatccatgaaacactgatacagatacgaacatatgacac 56  Q
    ||||||||||| ||  |||||||||||||||||||||||||||||||||||    
31614536 aacatcatttagcaagcatgaaacactgatacagatacgaacatatgacac 31614486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 192 - 229
Target Start/End: Complemental strand, 31614392 - 31614355
Alignment:
192 tgaaattgacatatttatacataatactttgaaaaata 229  Q
    ||||||||||||||||||||||||||||||||||||||    
31614392 tgaaattgacatatttatacataatactttgaaaaata 31614355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University