View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1168_high_27 (Length: 216)
Name: NF1168_high_27
Description: NF1168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1168_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 14737945 - 14737828
Alignment:
| Q |
1 |
cactttaacatttcactctactactttttatggcccctacatnnnnnnnttcttggatctgccacaaaacttgttagagaaaaatatggttgaaaaaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14737945 |
cactttaacatttcactctactactttttatggcccctacataaaaaaattcttggatccgccacaaaacttgttagagaaaaatatggttgaaaaaata |
14737846 |
T |
|
| Q |
101 |
tatgatgaaaagttgatg |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14737845 |
tatgatgaaaagttgatg |
14737828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 31
Target Start/End: Complemental strand, 19358534 - 19358506
Alignment:
| Q |
3 |
ctttaacatttcactctactactttttat |
31 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19358534 |
ctttaacatttcactctactactttttat |
19358506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 61 - 112
Target Start/End: Original strand, 17588893 - 17588944
Alignment:
| Q |
61 |
gccacaaaacttgttagagaaaaatatggttgaaaaaatatatgatgaaaag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17588893 |
gccacaaaacttgttagagaaaaatatggttgaaaaaatatttgatgaaaag |
17588944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 17588751 - 17588779
Alignment:
| Q |
1 |
cactttaacatttcactctactacttttt |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17588751 |
cactttaacatttcactctactacttttt |
17588779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University