View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1168_high_30 (Length: 203)

Name: NF1168_high_30
Description: NF1168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1168_high_30
NF1168_high_30
[»] chr3 (1 HSPs)
chr3 (101-151)||(9092773-9092823)


Alignment Details
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 101 - 151
Target Start/End: Original strand, 9092773 - 9092823
Alignment:
101 cagagacgaagtcggtggtgccagcgagcgattataccagaaaattggttc 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
9092773 cagagacgaagtcggtggtgccagcgagcgattataccagaaaattggttc 9092823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University