View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1168_low_10 (Length: 484)
Name: NF1168_low_10
Description: NF1168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1168_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 1 - 387
Target Start/End: Original strand, 36523747 - 36524126
Alignment:
| Q |
1 |
ttatgatagcaccttccctgatggtatctccaacaaacaagacattcttggatgcttgtctcttatcatctatactatttcacttattgtctttgtcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36523747 |
ttatgatagcaccttccctgatggtatctccaacaaacaagaccttcttggatgcttgtctcttatcatctatactatttcacttattgtctttgtcaaa |
36523846 |
T |
|
| Q |
101 |
tacatccttgttgtcttatgggctaatgacaacggtaacggtaagtatatagaatgattttgtctaatgttcacaatcaaataagtattgcactacgcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
36523847 |
tacatccttgttgtcttatgggctaatgacaacggtaacggtaagtatatagaatgattttgtctaatgttcacaatcaaataagtgttgcactacg--c |
36523944 |
T |
|
| Q |
201 |
acgaatggtgagacttgttgatcaaatggtaaaaatatccttgatacaagacatcacataggtcacaatcaaagaagaataactgtatttattttttaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
36523945 |
acgaatggtgagacttgttgatcaaatggtaaaaatatccttgatacaag-----acataggtcacaatcaaagaagaataactttatttatttttgaat |
36524039 |
T |
|
| Q |
301 |
ggatattattaggtggcacatgtgcattgtattctttgatttgccggcactcgaaggtgagcttaattccaaatcaccaaccagaag |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36524040 |
ggatattattaggtggcacatgtgcattgtattctttgatttgccggcactcgaaggtgagcttaattccaaatcaccaaccagaag |
36524126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University