View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1168_low_13 (Length: 439)
Name: NF1168_low_13
Description: NF1168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1168_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 4e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 141 - 299
Target Start/End: Complemental strand, 23522534 - 23522376
Alignment:
| Q |
141 |
acataaacatcaacataatattgtattttaccaactgcttctatgtccaactgcacataactaatctaattttgcaggctttacatgatttcccattctg |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522534 |
acataaacatcaacgtaatattgtattttaccaactgcttctatgtccaactgcacataactaatctaattttgcaggctttacatgatttcccattctg |
23522435 |
T |
 |
| Q |
241 |
atcacgatgccatcaatatctctcacgtacccaaccttttggccccactccttcatctc |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522434 |
atcacgatgccatcaatatctctcacgtacccaaccttttggccccactccttcatctc |
23522376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University