View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1168_low_15 (Length: 433)
Name: NF1168_low_15
Description: NF1168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1168_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 50 - 315
Target Start/End: Complemental strand, 3080505 - 3080240
Alignment:
| Q |
50 |
tgtatgtaaaaatgtaggttttttccaacttatctttggcttaagatttttctatcttcagccgtgacaccattttttaactctaaatttttgtcatcta |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3080505 |
tgtatgtaaaaatgtaggttttttccaacttatctttggcttaagatttttctatcttcagccgtgacaccattttttaactctaaatttttgtcatcta |
3080406 |
T |
 |
| Q |
150 |
aaaagatttagtttaacattccttcaattcttctaatagtttttgtaggaatatctaatataaacctagcctagtannnnnnnnnnnnnnnngaggaaaa |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3080405 |
aaaagatttagtttaacattccttcaattcttctaatagtttttgtaggaatatctaatataaacctagcctagtattttttttttttttttgaggaaaa |
3080306 |
T |
 |
| Q |
250 |
acctagcctagtattggatcttactctttctagtaaatttaataaaatacgacatctatatcctac |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
3080305 |
acctagcctagtattggatcttactctttcttgtaaatttaacaaaatacgacatctatatcctac |
3080240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University