View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1168_low_23 (Length: 322)
Name: NF1168_low_23
Description: NF1168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1168_low_23 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 97 - 322
Target Start/End: Original strand, 33794812 - 33795037
Alignment:
| Q |
97 |
caatcaacattagaactacatcaatccaatcaccatatctcaaaattatgcctattgaacctccctcttttactttcatcacctcaccctctttcttaga |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33794812 |
caatcaacattagaactacatcaatccaatcaccatatctcaaaattatgcctattgaacctccctcttttactttcatcacctcaccctctttcttaga |
33794911 |
T |
 |
| Q |
197 |
acccatagcttcactctatgtgtgaaagctaacttcttattataagattatttattgcaaagaagagagggataggtttataatacatattagttgttac |
296 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33794912 |
acccatagcttcactctatgtgtgagagctaacttcttattataagattatttattgcaaagaagagagggataggtttataatacatattagttgttac |
33795011 |
T |
 |
| Q |
297 |
acactacttatatataagtgtaaagt |
322 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
33795012 |
acactacttatatataagtgtaaagt |
33795037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University