View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1168_low_30 (Length: 252)
Name: NF1168_low_30
Description: NF1168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1168_low_30 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 44 - 252
Target Start/End: Original strand, 26491135 - 26491343
Alignment:
| Q |
44 |
tgaagtgaacttatgactgcctatgtggtgcaaatagatttagaataaggatgacatcattttgtgcaacgtatagaggttaatgagaatcatatttatg |
143 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
26491135 |
tgaagtgaacttacgactgcctatgtggtgcaaatagatttggaataaggatgacatcattttgtgcaacgtatagaggtcaatgagagtcatatttatg |
26491234 |
T |
 |
| Q |
144 |
ctttaatattaaaatgttacacacatatatgtgttgcctacactacttaaaattcctggatccgtcttaacaccgatattatacatgaattaaatccata |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26491235 |
ctttaatattaaaatgttacacacatatatgtgttgcctacactacttaaaattcctgaatccatcttaacaccgatattatacatgaattaaatccata |
26491334 |
T |
 |
| Q |
244 |
aactgatgt |
252 |
Q |
| |
|
||||||||| |
|
|
| T |
26491335 |
aactgatgt |
26491343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University