View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1168_low_33 (Length: 228)
Name: NF1168_low_33
Description: NF1168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1168_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 23522533 - 23522418
Alignment:
| Q |
1 |
cataaacatcaacataatattgtattttaccaactgcttctatgtccaactgcacataactaatctaattttgcaggctttacatgatttcccattctga |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522533 |
cataaacatcaacgtaatattgtattttaccaactgcttctatgtccaactgcacataactaatctaattttgcaggctttacatgatttcccattctga |
23522434 |
T |
 |
| Q |
101 |
tcacgatgccatcaat |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
23522433 |
tcacgatgccatcaat |
23522418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 112 - 213
Target Start/End: Original strand, 52792094 - 52792195
Alignment:
| Q |
112 |
tcaatcatatgcttgattgtttgtgatacctcaatcaaatgcttaatttgtgccatgaataaaatatatgaaaaaacatatttaaattatcctcaaataa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52792094 |
tcaatcatatgcttgattgtttgtgatacctcaatcaaatgcttaatttgtgccatgaataaaatatatgaaaaaacatatttaaattatcctcaaataa |
52792193 |
T |
 |
| Q |
212 |
ct |
213 |
Q |
| |
|
|| |
|
|
| T |
52792194 |
ct |
52792195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University