View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1168_low_35 (Length: 225)
Name: NF1168_low_35
Description: NF1168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1168_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 40 - 201
Target Start/End: Original strand, 12354654 - 12354816
Alignment:
| Q |
40 |
gttgctcaagaaaaatcctccac-atggggaataaaacaaactgaagcagttaaaatcttgaaaaagttttctcaaactccacctgccctaaaaattcca |
138 |
Q |
| |
|
||||||||||||||||||||||| || |||| |||| |||| |||||| ||||||||||||||||| || |||||||||||||||||| |||||||||| |
|
|
| T |
12354654 |
gttgctcaagaaaaatcctccaccatctggaacaaaataaaccgaagcaattaaaatcttgaaaaaggttgctcaaactccacctgccccaaaaattcca |
12354753 |
T |
|
| Q |
139 |
ggagatggaaaaagaatttaacaaactgatgctattgatcactattggggagcagtcgttata |
201 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
12354754 |
ggagatggaaaaagaattctacaaactgatgctagtgatcactattggggagcagtccttata |
12354816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University