View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1168_low_38 (Length: 215)
Name: NF1168_low_38
Description: NF1168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1168_low_38 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 4 - 134
Target Start/End: Complemental strand, 17594978 - 17594848
Alignment:
| Q |
4 |
tcatcatatcctttggttttcccaaccaaaaaatatgttccaagtccaaataatattggaataattgttccaacaattgcaatgcttgatgccttttttc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17594978 |
tcatcatatcctttggttttcccaaccaaaaaatatgttccaagtccaaataatattggaataattgttccaacaattgcaatgcttgatgccttttttc |
17594879 |
T |
|
| Q |
104 |
ttgctcttagtactgagtctaagttcatctc |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17594878 |
ttgctcttagtactgagtctaagttcatctc |
17594848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University