View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1168_low_40 (Length: 205)

Name: NF1168_low_40
Description: NF1168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1168_low_40
NF1168_low_40
[»] chr1 (2 HSPs)
chr1 (54-119)||(12105094-12105159)
chr1 (1-41)||(12105597-12105637)


Alignment Details
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 54 - 119
Target Start/End: Complemental strand, 12105159 - 12105094
Alignment:
54 taaatatatagggttaaaattactttattttatttttagtttaactcaaccgacaaagttgatatt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12105159 taaatatatagggttaaaattactttattttatttttagtttaactcaaccgacaaagttgatatt 12105094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 12105637 - 12105597
Alignment:
1 ggagatcatgaaagatgagagtgagatgttgaataatgaga 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
12105637 ggagatcatgaaagatgagagtgagatgttgaataatgaga 12105597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University