View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11690_high_15 (Length: 389)
Name: NF11690_high_15
Description: NF11690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11690_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 16 - 382
Target Start/End: Original strand, 32805708 - 32806068
Alignment:
| Q |
16 |
gaaagtgtggctgtcagcgccggacacccgtgcccaacaattattctgctactccctctggctgatttggagtcacaggaaccaactggtttttaaccaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32805708 |
gaaagtgtggctgtcagcgccggacacccgtgcccaacaattattctgctactccctctggctgatttggagtcacaggaaccaactggtttttaaccaa |
32805807 |
T |
|
| Q |
116 |
tctgtgtttgagcctattgttatttcgaagaaggcagcctctttagttgaggagttcaactctgttaatcctccccgaaactcccctccggttagtgctc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||||||||||| |
|
|
| T |
32805808 |
tctgtgtttgagcctattgttatttcgaagaaggcagcctctttagttgaggagttcaactctgtgaatcctccccgaaactctcctctggttagtgctc |
32805907 |
T |
|
| Q |
216 |
tcactaagtggattccacctcctagtggttatgttaatgttaagatcaatgtcgatttcgggtgttttagtgatggtacgacaggttgggggatggttgt |
315 |
Q |
| |
|
||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32805908 |
tcaataagtggattccacctcctagtggtt------atgttaagatcaatgtcgatgccgggtgttttagtgatggtacgacaggttgggggatggttgt |
32806001 |
T |
|
| Q |
316 |
gcgcaacgctgcaggtctggttttgtttgcagagacaagatttgatggtatctcggtgtcacctttg |
382 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32806002 |
gcgcaacgctgcaggtctggttttgtgtgcagagacaagatttgatggtatttcggtgtcacctttg |
32806068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 16 - 382
Target Start/End: Complemental strand, 6095209 - 6094849
Alignment:
| Q |
16 |
gaaagtgtggctgtcagcgccggacacccgtgcccaacaattattctgctactccctctggctgatttggagtcacaggaaccaactggtttttaaccaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
6095209 |
gaaagtgtggctgtcagcgccggacacccgtgcccaacaattattctgctactccctctggctgatttggagtcataggaaccaactagtttttaaccaa |
6095110 |
T |
|
| Q |
116 |
tctgtgtttgagcctattgttatttcgaagaaggcagcctctttagttgaggagttcaactctgttaatcctccccgaaactcccctccggttagtgctc |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6095109 |
tctgtgtttgagcctattgttatttcaaagaaggcagcctctttagttgaggagttcaactctgttaatcctccctgaaactcccctccggttagtgctc |
6095010 |
T |
|
| Q |
216 |
tcactaagtggattccacctcctagtggttatgttaatgttaagatcaatgtcgatttcgggtgttttagtgatggtacgacaggttgggggatggttgt |
315 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6095009 |
tcactaagtggattccacttcctagtggttatg------ttaagatcaacgtcgatgccgggtgttttagtgatggtacgacaggttgggggatggttgt |
6094916 |
T |
|
| Q |
316 |
gcgcaacgctgcaggtctggttttgtttgcagagacaagatttgatggtatctcggtgtcacctttg |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6094915 |
gcgcaacgctgcaggtctggttttgtttgcagagacaagatttgatggtatctcggtgtcacctttg |
6094849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University