View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11691_high_17 (Length: 299)
Name: NF11691_high_17
Description: NF11691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11691_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 27 - 134
Target Start/End: Original strand, 42821881 - 42821988
Alignment:
| Q |
27 |
ttgaggatatagctgaggcagcactttatttgagtagtgatgagtccaagtttgttaatggagtcaactttgttttggatggaggttatagcaccaccaa |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42821881 |
ttgaggatatagctgaggcagcactttatttgagtagtgatgagtccaagcttgttaatggagtcaactttgttttggatggaggttatagcaccaccaa |
42821980 |
T |
 |
| Q |
127 |
tatgtcat |
134 |
Q |
| |
|
|||||||| |
|
|
| T |
42821981 |
tatgtcat |
42821988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University