View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11691_high_17 (Length: 299)

Name: NF11691_high_17
Description: NF11691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11691_high_17
NF11691_high_17
[»] chr7 (1 HSPs)
chr7 (27-134)||(42821881-42821988)


Alignment Details
Target: chr7 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 27 - 134
Target Start/End: Original strand, 42821881 - 42821988
Alignment:
27 ttgaggatatagctgaggcagcactttatttgagtagtgatgagtccaagtttgttaatggagtcaactttgttttggatggaggttatagcaccaccaa 126  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
42821881 ttgaggatatagctgaggcagcactttatttgagtagtgatgagtccaagcttgttaatggagtcaactttgttttggatggaggttatagcaccaccaa 42821980  T
127 tatgtcat 134  Q
    ||||||||    
42821981 tatgtcat 42821988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University