View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11691_high_19 (Length: 274)
Name: NF11691_high_19
Description: NF11691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11691_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 4619913 - 4620164
Alignment:
| Q |
16 |
ataatggcaggaaacatctctggtccaagtgtgagcaatgctgctaatattttgctgaatcatgacttctcaaatgacctgaactcttggcatctcaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4619913 |
ataatggcaggaaacatctctggtccaagtgtgagcaatgctgctaatattttgctgaatcatgacttctcaaatgacctgaactcttggcatctcaatt |
4620012 |
T |
 |
| Q |
116 |
gctgcaatggctatgtaatttcgtccaaagcaggtggtcaaggtgtaaatttgatggattcggattgtaattatgccgttatcaccgaccgaaacgaagg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4620013 |
gctgcaatggctatgtaatttcgtccaaagcaggtggtcaaggtgtaaatttgatggattcggattgtaattatgctgttatcaccgaccgaaacgaagg |
4620112 |
T |
 |
| Q |
216 |
ctggcaaggtcttgagcaagatatcacagacagaatttccacaggttctgct |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4620113 |
ctggcaaggtcttgagcaagatatcacagacagaatttccattggttctgct |
4620164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University