View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11691_high_27 (Length: 210)
Name: NF11691_high_27
Description: NF11691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11691_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 11 - 193
Target Start/End: Original strand, 1582379 - 1582561
Alignment:
| Q |
11 |
gagaagaatgaatgggtgacattgacattggcccaacaacaacgcgtggtgacaatggacgagcacttgatagagaaagaggggtctggtaatgcacttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1582379 |
gagaagaatgaatgggtgacattgacattggcccaacaacaatgcgtggtgacaatggacgatcacgtgatagagaaagaggggtctggtaatgcacttt |
1582478 |
T |
 |
| Q |
111 |
caataatagttcttggaatgtgtagcattcttcggttggttttgggaatgtgaaggaatctgtttcgagtacgtcgtcatcaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1582479 |
caataatagttcttggaatgtgtagcattcttcggttggttttgggaatgtgaaggaatctgtttcgagtacgtcgtcatcaa |
1582561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University