View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11691_high_27 (Length: 210)

Name: NF11691_high_27
Description: NF11691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11691_high_27
NF11691_high_27
[»] chr4 (1 HSPs)
chr4 (11-193)||(1582379-1582561)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 11 - 193
Target Start/End: Original strand, 1582379 - 1582561
Alignment:
11 gagaagaatgaatgggtgacattgacattggcccaacaacaacgcgtggtgacaatggacgagcacttgatagagaaagaggggtctggtaatgcacttt 110  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||    
1582379 gagaagaatgaatgggtgacattgacattggcccaacaacaatgcgtggtgacaatggacgatcacgtgatagagaaagaggggtctggtaatgcacttt 1582478  T
111 caataatagttcttggaatgtgtagcattcttcggttggttttgggaatgtgaaggaatctgtttcgagtacgtcgtcatcaa 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1582479 caataatagttcttggaatgtgtagcattcttcggttggttttgggaatgtgaaggaatctgtttcgagtacgtcgtcatcaa 1582561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University