View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11691_low_15 (Length: 328)
Name: NF11691_low_15
Description: NF11691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11691_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 17 - 318
Target Start/End: Complemental strand, 29048598 - 29048297
Alignment:
| Q |
17 |
tttggtacctttgtttttaaatgtacaataatgtcattgcttgcatcatcgaactgttctttttcttcttttgcattgcggaggcgtgtacgtgcagatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29048598 |
tttggtacctttgtttttaaatgtacaataatgtcattgcttgcatcatcgaactgttctttttcttcttttgcattgcggaggcgtgtacgtgcagatg |
29048499 |
T |
 |
| Q |
117 |
tcaacaacatgttcacctacaatagaatctttgtcacataaactttgatataatcaatgcagatgcaacaaaacttaaaaaggtgcaggttctgaattca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29048498 |
tcaacaacatgttcacctacaatagaatctttgtcacataaactttgatataatcaatgcagatgcaacaaaacttaaaaaggtgaaggttctgaattca |
29048399 |
T |
 |
| Q |
217 |
agtgtcttttagcattgtaattcagagtattcaagaagagatagaatagaaaacctttttcagtttgtcttcgagctcatttttctgcttctcgagttct |
316 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29048398 |
agtgtcttttagcattgtaattcagggtattcaagaagagattgaatagaaaacctttttcagtttgtcttcgagctcatttttctgcttctcgagttct |
29048299 |
T |
 |
| Q |
317 |
tc |
318 |
Q |
| |
|
|| |
|
|
| T |
29048298 |
tc |
29048297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University