View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11691_low_23 (Length: 236)
Name: NF11691_low_23
Description: NF11691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11691_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 15 - 220
Target Start/End: Complemental strand, 26812528 - 26812321
Alignment:
| Q |
15 |
caaaggacatgagacttggaagtgaaccatc--atgctcaaaggacatgtaggcagaaatacaactactagatgatatgctaatccataaaattgaagtg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26812528 |
caaaggacatgagacttggaagtgaaccatctgatgctcaaaggacatgtaggcagaaatacaactactagatgatatgctaatccataaaattgaagtg |
26812429 |
T |
 |
| Q |
113 |
ggtttgacgaaatgatcaattttgcttatcctgatttgttgaataacatgtctagtatgtcaggaagtgatttagcaacaatttaaggttcactaacaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26812428 |
ggtttgacgaaatgatcaattttgcttatcctgatttgttgaataacatgtctagtatgtcaggaagtgatttagcaacaatttaaggttcactaacaat |
26812329 |
T |
 |
| Q |
213 |
gtaatgac |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
26812328 |
gtaatgac |
26812321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University