View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11693_high_6 (Length: 368)
Name: NF11693_high_6
Description: NF11693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11693_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 1 - 350
Target Start/End: Original strand, 31573767 - 31574116
Alignment:
| Q |
1 |
aaaggtccacaacatgcaaaaaactttagctagatttgaagagtatagagagatggtgaaaattaaagcaagcaaactccagaagaaacatcctaggtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31573767 |
aaaggtccacaacatgcaaaaaactttagctagatttgaagagtatagagagatggtgaaaattaaagcaagcaaactccagaagaaacatcctaggtgt |
31573866 |
T |
 |
| Q |
101 |
ctagctgatggaaatgaacttttaaggttctatggaaccacagttgcttgttctcttggtctcaatggctcttcaagtctttgtttatcagaaaaatgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31573867 |
ctagctgatggaaatgaacttttaaggttctatggaaccacagttgcttgttctcttggtctcaatggctcttcaagtctttgtttatcagaaaaatgtt |
31573966 |
T |
 |
| Q |
201 |
gtgtttgtagaatcattaggagtggtttttctgctaagaaggaattgaaaggtggcataggtgttttcacaacatctacaagtggaagagcttttgaatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31573967 |
gtgtttgtagaatcattaggagtggtttttctgctaagaaggaattgaaaggtggcataggtgttttcacaacatctacaagtggaagagcttttgaatc |
31574066 |
T |
 |
| Q |
301 |
tatagagatttttgataatgaaccttcacttagaaaggcattgatagtat |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31574067 |
tatagagatttttgataatgaaccttcacttagaaaggcattgatagtat |
31574116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University