View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11694_high_24 (Length: 280)
Name: NF11694_high_24
Description: NF11694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11694_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 267
Target Start/End: Original strand, 3093622 - 3093888
Alignment:
| Q |
1 |
cccgactcccctgcaattaaggaatccatgcattcatgcagtcggacggtagtcgtttgatcaaaactgaacaagtcatattcaatcgcgatattttcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3093622 |
cccgactcccctgcaattaaggaatccatgcattcatgcagtcggacggtagtcgtttgatcaaaattgaacaagtcatattcaatcgcgatattttcta |
3093721 |
T |
 |
| Q |
101 |
ttggtaaaataaaaatctgtatttttatggagcatccgatcatggtcatcagattgtcaacattgtcacgaatgtgagatcccatagtccgccttcatat |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3093722 |
tcggtaaaataaaaatctgtatttttatggagcatccgatcatggtcatcagattgtcaacattgtcacgaatgtgagatcccatagtccgccttcatat |
3093821 |
T |
 |
| Q |
201 |
atttctaagtataaatattgatgttatttttaatttgctcacaaatattacaaatgcagattggtca |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3093822 |
atttctaagtataaatattgatgttatttttaatttgctcacaaatattacaaatgcagattggtca |
3093888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 267
Target Start/End: Original strand, 3084999 - 3085042
Alignment:
| Q |
224 |
ttatttttaatttgctcacaaatattacaaatgcagattggtca |
267 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3084999 |
ttatttttaatttactcacaaatattacaaatgcagattggtca |
3085042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University