View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11694_high_25 (Length: 271)
Name: NF11694_high_25
Description: NF11694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11694_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 43212681 - 43212919
Alignment:
| Q |
18 |
acatcacagggttattcaaagagcatcctaaatttgcaagcgcatcaaagcattgatttacctcttggtatgaatgagcgactttcacttcccattcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43212681 |
acatcacagggttattcaaagagcatcctaaatttgcaagcgcatcaaagcattgatttacctcttggtatgaatgagcgaccttcacttcccattcatt |
43212780 |
T |
 |
| Q |
118 |
gaattgattaatgtagacactaaattgattgacggtatttaatttcagtataatctgtcataagtttggaagatcaaattgtccaaagggccatatctcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43212781 |
gaattgattaatgtagacactaaattgattgacggtatttaatttcagtataatctgtcataagtttggaagatcaaattgtccaaagggccatacctcc |
43212880 |
T |
 |
| Q |
218 |
atcatccccccttcaaactattctagaccagatgatgct |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43212881 |
atcatccccccttcaaactattctagaccagatgatgct |
43212919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University