View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11694_low_17 (Length: 324)
Name: NF11694_low_17
Description: NF11694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11694_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 18 - 309
Target Start/End: Original strand, 38762439 - 38762730
Alignment:
| Q |
18 |
catgtatgtgttggttatgtataaagtctgtaaaacctagttcaactgccgaagttgttggttgaacatctttacttgagtttgaacttgaacctcacag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| ||| |
|
|
| T |
38762439 |
catgtatgtgttggttatgtataaagtctgtaaaacctagttcaattgccgaagttgttggttgaacatctttactcgagtttgaacttgaaccttgcag |
38762538 |
T |
 |
| Q |
118 |
ttatatgtgagagtcggtgtttaccacttcttttacacaccaaaacaaaaactatataatatataatgaaatttgttgatctatgatcaggatcacatcg |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762539 |
ttatatgtgagagtctgtgtttaccacttcttttacacaccaaaacaaaaactatataatatataatgaaatttgttgatctatgatcaggatcacatcg |
38762638 |
T |
 |
| Q |
218 |
agtttggacatatatggtattgctctaataaacacttctgcaactttggccgctgccactactaactgtctcccagtgattaccttcttctt |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38762639 |
agtttggacatatatggtattgctctaataaacacttctgcaactttggccgctgccactactaactgtctcccagtgattaccttcttctt |
38762730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University