View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11694_low_36 (Length: 216)
Name: NF11694_low_36
Description: NF11694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11694_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 8e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 46749519 - 46749638
Alignment:
| Q |
1 |
agttcaaaacatttaccattaaatatttcaatttacattgtttgttccaaaatgtgcactcaattgttagttcactcatcttagaagttagagtgtatct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46749519 |
agttcaaaacatttaccattaaatatttcaattttcattctttgttccaaaatgtgcactcaattgttagttcactcatcttagaagttagagtgtatct |
46749618 |
T |
 |
| Q |
101 |
atgaaactacgacacaaagt |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
46749619 |
atgaaactacgacacaaagt |
46749638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 116 - 196
Target Start/End: Complemental strand, 46749428 - 46749348
Alignment:
| Q |
116 |
aaagtcgcaaggcaccaaataaggtgctaaagtaaatcttagccctccaaacaatcaagcggtcacccgacctttgtgcca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46749428 |
aaagtcgcaaggcaccaaataaggtgctaaagtaaatcttagccctccaaacaatcaagcggtcacccgacctttgtgcca |
46749348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University