View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11694_low_9 (Length: 414)
Name: NF11694_low_9
Description: NF11694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11694_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 17 - 401
Target Start/End: Original strand, 38424147 - 38424531
Alignment:
| Q |
17 |
aaaacaattttaaaggattgttcatgtgaaagttgagcttaaaccacctctctccgaactcattatatttcttcacgtacgtaacgtaatacgaatcgtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38424147 |
aaaacaattttaaaggattgttcatgtgaaagttgagcttaaaccacctctctccgaactcattatatttcttcacgtacgtaacgtaatacgaatcgtt |
38424246 |
T |
|
| Q |
117 |
tgagttatcttgcaggagtctgttacttgtgagttttctcttcaagggtcttataatatttttacggggttatagggtggcaacctgccatgccaccaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38424247 |
tgagttatcttgcaggagtctgttacttgtgagttttctcttcaagggtcttataatatttttacggggttatagggtggcaacctgccatgccaccaaa |
38424346 |
T |
|
| Q |
217 |
tctttttcgtttgttttcagtgttcgcctcttttggaggataaagtttagttctgctccagaaaatggttcttcagaaagtcttatatgatttctcatgt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38424347 |
tctttttcgtttgttttcagtgttcgcctcttttggaggataaagtttagttctgctccagaaaatggttcttcagaaagtcttatatgatttctcatgt |
38424446 |
T |
|
| Q |
317 |
aaccatgttccttgcatgaatgagtagtatagccttccttttgttttaggcagatagggtgtggattctccttcattttttgctc |
401 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38424447 |
aaccatgttccttgcatgaatgagtagtatagccttccttttgttttaggcagatagggtgtggattctccttcattttttgctc |
38424531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University