View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11695_high_2 (Length: 236)
Name: NF11695_high_2
Description: NF11695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11695_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 4458332 - 4458498
Alignment:
| Q |
1 |
cgacattcacaaatattcagatccaatttcatacctttatacaacttcaagtaagaaatcataacaatattgtggtaacccataaaatgtttcaccatac |
100 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
4458332 |
cgacatttacaaatattcagattcaatttcatacctttatacaacttcaagtaagaaatcataacaatattgtggtaacccctacaatgtttcaccatac |
4458431 |
T |
|
| Q |
101 |
tttcaatgtcaaatagattgatcaaatttggctctatcttgtcccaaacatcagtttcatcaccaac |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4458432 |
tttcaatgtcaaatagattgatcaaatttggctctatcttgccccaaacatcagtttcatcaccaac |
4458498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 113
Target Start/End: Original strand, 17541895 - 17541999
Alignment:
| Q |
9 |
acaaatattcagatccaatttcatacctttatacaacttcaagtaagaaatcataacaatattgtggtaacccataaaatgtttcaccatactttcaatg |
108 |
Q |
| |
|
||||||||| ||||| || ||| |||||||||| ||||| |||||| | || |||| ||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
17541895 |
acaaatattgagatcagatgtcacacctttatacggcttcatgtaagacaatttagcaattatgtggtaacccttacaatgtttcaccaaactttcaatc |
17541994 |
T |
|
| Q |
109 |
tcaaa |
113 |
Q |
| |
|
||||| |
|
|
| T |
17541995 |
tcaaa |
17541999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University