View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11696_low_1 (Length: 294)
Name: NF11696_low_1
Description: NF11696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11696_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 15 - 284
Target Start/End: Complemental strand, 53927851 - 53927581
Alignment:
| Q |
15 |
atataaactgtaaagtaagtaaaagaagtttccctcaccgtaaacgaaagaaacatggcgctattcatacccaaaacaacaaaagttacagttttagaca |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53927851 |
atattaactgtaaagtaagtaaaagaagtttccctctccgtaaacgaaagaaacatggcgctattcatacccaaaacaacaaaagttacagttttagaca |
53927752 |
T |
|
| Q |
115 |
attagcagaagattgtgtgccagatcaatgttttcaaaggcaaatcgcagagaataggggtttgtttgaattccactatgctacagcaccagtgtaggca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53927751 |
attagcagaagattgtgtgccagatcaatgttttcaaaggcaaatcgcagagaataggggtttgtttgaattccactatgctacagcaccagtgaaggca |
53927652 |
T |
|
| Q |
215 |
caatttgaaaacaatttgtactaattgcatcgcagaacaatagcagtttgtccaaactccgt-aatctgtg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
53927651 |
caatttgaaaacaatttgtactaattgcatcgcagaacaatagcagtttgtccaaactccgtcaatctgtg |
53927581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University