View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11698_high_15 (Length: 244)
Name: NF11698_high_15
Description: NF11698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11698_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 24142447 - 24142214
Alignment:
| Q |
1 |
aatcttccaattagggagatgacaataacacttgatgatgtgtcttgtctactgcatcccccattaatggtctcatattggaccataaacttcctatttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24142447 |
aatcttccaattagggagatgacaataacacttgatgatgtgtcttgtctactgcatcccccattaatggtctcatattggaccataaacttcctatttc |
24142348 |
T |
 |
| Q |
101 |
taggtctgagggtatgatgtggacgaggctaatagcaggtcnnnnnnncaaagggtgctcatgcacgtttcagctggtttaggacatattttaagaaacg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24142347 |
taggtctgagggtatgatgtggacgaggctaatagcaggtcaaaaaaacaaagggtgctcatgcacgtttcagctggtttaggacatattttaagaaaca |
24142248 |
T |
 |
| Q |
201 |
tctacaggaagcagctgagaaagagggtgatgtc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24142247 |
tctacaggaagcagctgagaaagagggtgatgtc |
24142214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 57
Target Start/End: Complemental strand, 18954498 - 18954443
Alignment:
| Q |
2 |
atcttccaattagggagatgacaataacacttgatgatgtgtcttgtctactgcat |
57 |
Q |
| |
|
|||||||| || ||||||||||||| | ||| ||||||||||| |||||||||||| |
|
|
| T |
18954498 |
atcttccagttggggagatgacaatgatactggatgatgtgtcatgtctactgcat |
18954443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 48
Target Start/End: Complemental strand, 20216397 - 20216363
Alignment:
| Q |
14 |
gggagatgacaataacacttgatgatgtgtcttgt |
48 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20216397 |
gggagatgacaatgacacttgatgatgtgtcttgt |
20216363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University