View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11698_high_15 (Length: 244)

Name: NF11698_high_15
Description: NF11698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11698_high_15
NF11698_high_15
[»] chr1 (1 HSPs)
chr1 (1-234)||(24142214-24142447)
[»] chr4 (1 HSPs)
chr4 (2-57)||(18954443-18954498)
[»] chr7 (1 HSPs)
chr7 (14-48)||(20216363-20216397)


Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 24142447 - 24142214
Alignment:
1 aatcttccaattagggagatgacaataacacttgatgatgtgtcttgtctactgcatcccccattaatggtctcatattggaccataaacttcctatttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24142447 aatcttccaattagggagatgacaataacacttgatgatgtgtcttgtctactgcatcccccattaatggtctcatattggaccataaacttcctatttc 24142348  T
101 taggtctgagggtatgatgtggacgaggctaatagcaggtcnnnnnnncaaagggtgctcatgcacgtttcagctggtttaggacatattttaagaaacg 200  Q
    |||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||     
24142347 taggtctgagggtatgatgtggacgaggctaatagcaggtcaaaaaaacaaagggtgctcatgcacgtttcagctggtttaggacatattttaagaaaca 24142248  T
201 tctacaggaagcagctgagaaagagggtgatgtc 234  Q
    ||||||||||||||||||||||||||||||||||    
24142247 tctacaggaagcagctgagaaagagggtgatgtc 24142214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 57
Target Start/End: Complemental strand, 18954498 - 18954443
Alignment:
2 atcttccaattagggagatgacaataacacttgatgatgtgtcttgtctactgcat 57  Q
    |||||||| || ||||||||||||| | ||| ||||||||||| ||||||||||||    
18954498 atcttccagttggggagatgacaatgatactggatgatgtgtcatgtctactgcat 18954443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 48
Target Start/End: Complemental strand, 20216397 - 20216363
Alignment:
14 gggagatgacaataacacttgatgatgtgtcttgt 48  Q
    ||||||||||||| |||||||||||||||||||||    
20216397 gggagatgacaatgacacttgatgatgtgtcttgt 20216363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University