View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11698_high_16 (Length: 243)
Name: NF11698_high_16
Description: NF11698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11698_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 231
Target Start/End: Complemental strand, 50918400 - 50918184
Alignment:
| Q |
17 |
ttttgttctgcttcgtacaaaggaattgtgtgtttcaaagtatcattgttttgcctcgaatcataaccaaaatggtaacttttctaattgtccattatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50918400 |
ttttgttctgcttcgtacaaaggaattgtgtggttcaaagtatcattgttttgcctcgaatcataaccgaaatggtaacttttctaattgtccattatct |
50918301 |
T |
|
| Q |
117 |
tgttttagttttatagtttgtg--tcttacggggcgtgaggaatggtgtgtgggtggggtgggtgttaatggtcccacattgaatgtgaagtggccttaa |
214 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
50918300 |
tgttttaattttatagtttgtgtctcttacggggcgtgaggaatggtgtgtgggtggggtgggtgttaatggtcccacattgaatgtgaagtggcctcaa |
50918201 |
T |
|
| Q |
215 |
aatgttgtcatatgtct |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
50918200 |
aatgttgtcatatgtct |
50918184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University