View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11698_low_16 (Length: 284)

Name: NF11698_low_16
Description: NF11698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11698_low_16
NF11698_low_16
[»] chr2 (1 HSPs)
chr2 (14-268)||(43585134-43585388)
[»] chr8 (1 HSPs)
chr8 (14-266)||(4190049-4190301)
[»] chr4 (1 HSPs)
chr4 (72-145)||(23339461-23339534)
[»] chr7 (2 HSPs)
chr7 (81-130)||(7655586-7655635)
chr7 (75-142)||(41418460-41418527)
[»] chr5 (1 HSPs)
chr5 (101-217)||(3929549-3929665)
[»] chr1 (1 HSPs)
chr1 (81-130)||(52103081-52103130)


Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 14 - 268
Target Start/End: Original strand, 43585134 - 43585388
Alignment:
14 gacatcaggtgcagctcttgatcctgctggattagtagcagttgctgtttgtcatggttttgctctttttgttgctgtttctgttggagccaacatatct 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43585134 gacatcaggtgcagctcttgatcctgctggattagtagcagttgctgtttgtcatggttttgctctttttgttgctgtttctgttggagccaacatatct 43585233  T
114 ggtggacatgtcaacccagctgtgacctttgggttggctattgggggacagatcactatcctcactggtatcttctactggattgcacaacttcttggtt 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43585234 ggtggacatgtcaacccagctgtgacctttgggttggctattgggggacagatcactatcctcactggtatcttctactggattgcacaacttcttggtt 43585333  T
214 ccatagtagcatgctttctcctcaagtatgccacaggaggcttggtatgtttatc 268  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
43585334 ccatagtggcatgctttctcctcaagtatgccacaggaggcttggtatgtttatc 43585388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 129; Significance: 8e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 14 - 266
Target Start/End: Complemental strand, 4190301 - 4190049
Alignment:
14 gacatcaggtgcagctcttgatcctgctggattagtagcagttgctgtttgtcatggttttgctctttttgttgctgtttctgttggagccaacatatct 113  Q
    |||||||| ||||||||||||||| || || ||| |||||||||||||||| ||||||||||| ||||||||||||||| | ||||| |||||||| |||    
4190301 gacatcagatgcagctcttgatccagcagggttactagcagttgctgtttgccatggttttgcactttttgttgctgttgcagttggtgccaacatttct 4190202  T
114 ggtggacatgtcaacccagctgtgacctttgggttggctattgggggacagatcactatcctcactggtatcttctactggattgcacaacttcttggtt 213  Q
    ||||| ||||||||||| ||||| |||||||| |||||| |||| |||||||| || ||||||||||||||||||||||||||||| || |||||||| |    
4190201 ggtggtcatgtcaaccctgctgtcacctttggattggctgttggtggacagattaccatcctcactggtatcttctactggattgctcagcttcttggat 4190102  T
214 ccatagtagcatgctttctcctcaagtatgccacaggaggcttggtatgttta 266  Q
    |||| || ||||| ||||| ||| ||| || ||| |||||||||||| |||||    
4190101 ccattgttgcatgttttcttctccagtttgtcactggaggcttggtaagttta 4190049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 72 - 145
Target Start/End: Original strand, 23339461 - 23339534
Alignment:
72 tttgctctttttgttgctgtttctgttggagccaacatatctggtggacatgtcaacccagctgtgacctttgg 145  Q
    ||||| |||||||||||||| |||||||| || ||||| |||||||||||||||||||| ||||| || |||||    
23339461 tttgcactttttgttgctgtctctgttggtgctaacatttctggtggacatgtcaaccctgctgtcacttttgg 23339534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 81 - 130
Target Start/End: Original strand, 7655586 - 7655635
Alignment:
81 tttgttgctgtttctgttggagccaacatatctggtggacatgtcaaccc 130  Q
    |||||||| |||||||||||||| |||||||||||||||||||| |||||    
7655586 tttgttgccgtttctgttggagcaaacatatctggtggacatgtgaaccc 7655635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 75 - 142
Target Start/End: Complemental strand, 41418527 - 41418460
Alignment:
75 gctctttttgttgctgtttctgttggagccaacatatctggtggacatgtcaacccagctgtgacctt 142  Q
    ||||| ||||||||||| || ||||| || ||||| || ||||||||||||||||| ||||| |||||    
41418527 gctctctttgttgctgtctccgttggtgctaacatctccggtggacatgtcaaccccgctgtcacctt 41418460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 101 - 217
Target Start/End: Original strand, 3929549 - 3929665
Alignment:
101 agccaacatatctggtggacatgtcaacccagctgtgacctttgggttggctattgggggacagatcactatcctcactggtatcttctactggattgca 200  Q
    ||||||||| || ||||||||| | ||||||||||| || ||||| || || ||||| ||  | ||||| ||||| |||||| ||||||| ||||||||     
3929549 agccaacatctcaggtggacatttgaacccagctgttacttttggattagccattggaggcaacatcaccatcctaactggtctcttctattggattgcc 3929648  T
201 caacttcttggttccat 217  Q
    ||| | ||||| |||||    
3929649 caattgcttggctccat 3929665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 81 - 130
Target Start/End: Complemental strand, 52103130 - 52103081
Alignment:
81 tttgttgctgtttctgttggagccaacatatctggtggacatgtcaaccc 130  Q
    ||||| |||||||||||||| || ||||| |||||||||||||| |||||    
52103130 tttgtggctgtttctgttggtgcaaacatttctggtggacatgtgaaccc 52103081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University