View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11698_low_6 (Length: 382)
Name: NF11698_low_6
Description: NF11698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11698_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 17 - 371
Target Start/End: Complemental strand, 50918400 - 50918045
Alignment:
| Q |
17 |
ttttgttctgcttcgtacaaaggaattgtgtgtttcaaagtatcattgttttgcctcgaatcataaccaaaatggtaacttttctaattgtccattatct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50918400 |
ttttgttctgcttcgtacaaaggaattgtgtggttcaaagtatcattgttttgcctcgaatcataaccgaaatggtaacttttctaattgtccattatct |
50918301 |
T |
 |
| Q |
117 |
tgttttagttttatagtttgtgtct--tacggggcgtgaggaatggtgtgtgggtggggtgggtgttaatggtcccacattgaatgtgaagtggccttaa |
214 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
50918300 |
tgttttaattttatagtttgtgtctcttacggggcgtgaggaatggtgtgtgggtggggtgggtgttaatggtcccacattgaatgtgaagtggcctcaa |
50918201 |
T |
 |
| Q |
215 |
aatgttgtcatatgtcttgggtagtcctcatcttcaaagccagttttgtaagggttaagttatgcttgacccaaatttttaagaattgtgttgttctttt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||| |
|
|
| T |
50918200 |
aatgttgtcatatgtcttgggtagtcctcatcttcaaagccagttttgtaagggttaagttatgcttgacccaga-ttttaagagttgtgttgttctttt |
50918102 |
T |
 |
| Q |
315 |
gaaatggcatatgctataatgccctcatacgtgtctgataaattgtgattggtctgt |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50918101 |
gaaatggcatatgctataatgccctcatacgtgtctgataaattgtgattggtctgt |
50918045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University