View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11699_low_7 (Length: 237)
Name: NF11699_low_7
Description: NF11699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11699_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 27778106 - 27778328
Alignment:
| Q |
1 |
ttcattgcagttctcctctcaatcccaataattggtgctggaatttggctatcaactttacaagcagaatcatgtgtcaaaatcttacaatggccagtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27778106 |
ttcattgcagttctcctctcaatcccaataattggtgctggaatttggctatcaactttacaagcagaatcatgtgtcaaaatcctacaatggccagtga |
27778205 |
T |
|
| Q |
101 |
tcattttagggatactaattttaattgttggtatggttggtttcattggagccttttggagaatcccaatgcttctcatattctacctcattgctatgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27778206 |
tcattttagggatactaattttaattgttggtatggttggtttcattggagccttttggagaatcccaatgcttctcatattctaccttattgctatgat |
27778305 |
T |
|
| Q |
201 |
tatgctcattgtattgttgggtt |
223 |
Q |
| |
|
| ||||||||||||||||||||| |
|
|
| T |
27778306 |
tgtgctcattgtattgttgggtt |
27778328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 14 - 51
Target Start/End: Original strand, 12639288 - 12639325
Alignment:
| Q |
14 |
tcctctcaatcccaataattggtgctggaatttggcta |
51 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
12639288 |
tcctctcaatcccaatcattggtgctggaatctggcta |
12639325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University