View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_27 (Length: 357)
Name: NF1169_high_27
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 342
Target Start/End: Complemental strand, 7763001 - 7762660
Alignment:
| Q |
1 |
gtccggtgtaacggataaaacggtgtttgggaggatggaacattggttggtgaagagcgagatgaagcgttgttcgattgaagaggatgcttttatggag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7763001 |
gtccggtgtaacggataaaacggtgtttgggaggatggaacattggttggtgaagagcgagatgaagcgttgttcgattgaagaggatgctttgatggag |
7762902 |
T |
|
| Q |
101 |
agttgttgggagataagggttttgatgagagagaagaaaggtgtgatagcgtttgagtttgagaattggggtggagggaaggtgttgatgatggtggaaa |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7762901 |
agttgttgggagattagggttttgatgagagagaagaaaggtgtgatagcgtttgagtttgagaattggggtggagggaaggtgttgatgatggtggaaa |
7762802 |
T |
|
| Q |
201 |
ggagtgggtcagcggcgcggaggtggttgagtgcggcggtgatttcgttttgtgatgttaatggttttgggattattggtgtgagaagaggaaagtgtgg |
300 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
7762801 |
ggagtgggtcagcagcgcggaggtggttgagtgcggcggtgatttcgttttgtgatgttaatggtttttggattattggtgtgagaaggggaaagtgtgg |
7762702 |
T |
|
| Q |
301 |
ttttttcacttcttctttggttttgatggtgggttttaggat |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7762701 |
ttttttcacttcttctttggttttgatggtgggtttaaggat |
7762660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University