View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1169_high_31 (Length: 337)
Name: NF1169_high_31
Description: NF1169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1169_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 35 - 242
Target Start/End: Original strand, 49751822 - 49752026
Alignment:
| Q |
35 |
cagagatcagaatcgaggaaagaatcgtattcttcgtcgttgaatttgggaggacgtgattgcttaatgaggagaaactcgttttggtttgaaggatttt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49751822 |
cagagatcagaatcgaggaaagaatcgtattcttcgtcgttgaatttgggaggacgtgattgcttaatgaggagaaactcgttttggtttgaaggatttt |
49751921 |
T |
 |
| Q |
135 |
ggatgatcaaagcgagtttgtgagttgccattgtccaagaattggaaaacggtagttgagcgacaagtttttattaacaacaagtacaaccaactcaact |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
49751922 |
ggatgatcaaagcgagtttgtgagttgccattgtccaagaactggaaaacggtagttgagcgacaagttt---ttaataacaagtacaaccaactcaact |
49752018 |
T |
 |
| Q |
235 |
tctattac |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
49752019 |
tctattac |
49752026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University